Jornal Brasileiro de Pneumologia

ISSN (on-line): 1806-3756

ISSN (impressa): 1806-3713

Busca avançada

 

Número Atual: 2011 - Volume 37 - Número 4 (Julho/Agosto)

ARTIGO ORIGINAL

Identificação de micobactérias não tuberculosas isoladas de sítios estéreis em pacientes em um hospital universitário na cidade do Rio de Janeiro

Identification of nontuberculous mycobacteria isolated from clinical sterile sites in patients at a university hospital in the city of Rio de Janeiro, Brazil

 

Simone Gonçalves Senna; Ana Grazia Marsico; Gisele Betzler de Oliveira Vieira; Luciana Fonseca Sobral; Philip Noel Suffys; Leila de Souza Fonseca

 

Resumo

Objetivo: Identificar micobactérias não tuberculosas (MNT) isoladas de sítios estéreis em pacientes internados no Hospital Universitário Clementino Fraga Filho, Rio de Janeiro (RJ) entre 2001 e 2006. Métodos: Durante o período do estudo, 34 isolados de MNT de sítios estéreis de 14 pacientes, a maioria HIV positivos, foram submetidos a identificação fenotípica e hsp65 PCR-restriction enzyme analysis (PRA, análise por enzimas de restrição por PCR do gene hsp65). Resultados: A maioria dos isolados foi identificada como Mycobacterium avium, seguida por M. monacense, M. kansasii e M. abscessus em menores proporções. Conclusões: A combinação de PRA, um método relativamente simples e de baixo custo, com algumas características fenotípicas pode fornecer a identificação correta de MNT na rotina de laboratórios clínicos.

 

Abstract

Objective: To identify nontuberculous mycobacteria (NTM) isolated from sterile sites in patients hospitalized between 2001 and 2006 at the Clementino Fraga Filho University Hospital, located in the city of Rio de Janeiro, Brazil. Methods: During the study period, 34 NTM isolates from sterile sites of 14 patients, most of whom were HIV-positive, were submitted to phenotypic identification and hsp65 PCR-restriction enzyme analysis (PRA). Results: Most isolates were identified as Mycobacterium avium, followed by M. monacense, M. kansasii, and M. abscessus. Conclusions: The combination of PRA, a relatively simple and inexpensive method, with the evaluation of a few phenotypic characteristics can allow NTM to be accurately identified in the routine of clinical laboratories.

 

 

Palavras-chave: Micobactérias atípicas; Biologia molecular; Reação em cadeia da polimerase.

 

Keywords: Mycobacteria, atypical; Molecular biology; Polymerase chain reaction.

 

 

Introdução

Nos últimos anos, o número de micobactérias não tuberculosas (MNT) isoladas de espécimes clínicos vem aumentando, em parte devido a infecções oportunistas que acompanham a imunossupressão. Tradicionalmente, o diagnóstico definitivo de infecções por micobactérias depende do isolamento e identificação dos agentes causadores e requer uma série de testes fisiológicos e bioquímicos específicos. Em razão de as espécies de micobactérias apresentarem diferentes sensibilidades a drogas, a identificação precisa é crucial para a adoção da terapia medicamentosa adequada, podendo, em última instância, afetar o desfecho dos pacientes.(1) Plikaytis et al.(2) e Telenti et al.,(3) utilizando regiões distintas do gene, descreveram a identificação bem sucedida de micobactérias por meio da análise de restrição por digestão de fragmentos amplificados do gene hsp65 - hsp65 PCR-restriction enzyme analysis (PRA, análise por enzimas de restrição por PCR do gene hsp65). A maioria dos padrões de DNA gerados pela análise por enzimas de restrição de produtos de PCR específicos para Mycobacterium são específicos para cada espécie, e a PRA de parte do gene hsp65 é apenas um método que tem sido utilizado como meio de identificação de espécies de micobactérias.(4) O objetivo do presente estudo foi identificar, por meio do método de PRA, isolados coletados entre 2001 e 2006 de sítios estéreis de pacientes clínicos internados em um hospital universitário na cidade do Rio de Janeiro (RJ).

Métodos

Entre 2001 e 2006, foram identificados 34 isolados de micobactérias atípicos de vários espécimes biológicos (pelo menos um de sítio estéril em cada paciente). Essas amostras foram coletadas de 14 pacientes internados no Hospital Universitário Clementino Fraga Filho, Rio de Janeiro (RJ). Os prontuários dos 14 pacientes foram revisados retrospectivamente. Dos 14 pacientes, 12 eram HIV positivos.

Os isolados foram cultivados em meio de Löwenstein-Jensen. A identificação fenotípica foi realizada por meio de testes bioquímicos padrão (arilsulfatase, catalase, hidrólise do Tween, redução do telurito, produção de niacina, urease e redução do nitrato),(5) bem como pela avaliação da produção de pigmentos, da taxa de crescimento e das características das colônias.

O ácido nucléico dos isolados clínicos foi extraído por imersão de uma alçada do crescimento de colônias do meio de cultura sólido em 50 µL de água ultrapura. A mistura foi fervida uma vez por 10 min e congelada a −20°C por toda a noite. Após breve centrifugação, utilizaram-se 10 µL de sobrenadante para a amplificação.

A preparação da PCR foi realizada com 10 µL do extrato de DNA genômico, 20 pmol de primers específicos para hsp65(3) - tb11 (ACCAACGATGGTGTGTCCAT) e tb12 (CTTGTCGAACCGCATACCCT) - 50 mM KCl, 10 mM Tris-HCl (pH 8,3), 1,5 mM MgCl2, glicerol a 50%, 200 µM desoxinucleotídeo trifosfato e 1,5 U de Taq polimerase (Invitrogen, Karlsruhe, Alemanha) para produzir um volume final de 50 µL. As reações foram realizadas utilizando-se um sistema de análise de DNA (Applied Biosystems, Foster City, CA, EUA). A amplificação por PCR foi realizada da seguinte forma: desnaturação a 94°C por 1 min; 45 ciclos de desnaturação a 94°C por 1 min, anelamento a 60°C por 1 min, extensão a 72°C por 1 min; e uma fase de extensão final a 72°C por 7 min, seguida de uma fase de resfriamento a 4°C. Para verificar o sucesso da amplificação, o produto da PCR foi aplicado em gel de agarose a 1% contendo brometo de etídio. Posteriormente, 15 µL dos produtos da PCR foram digeridos separadamente com as enzimas de restrição BstEII (incubadas a 60°C por 2 h) e HaeIII (a 37°C por 2 h), de acordo com as instruções do fabricante. Os produtos da digestão foram visualizados em gel de agarose ultrapura a 3% + (89 mM Tris, 89 mM ácido bórico, 2 mM EDTA; pH 8,0) + brometo de etídio. Os marcadores do tamanho do DNA - DNA ladder de 50 pb e 25 pb - foram aplicados em três linhas (uma em cada extremo do gel e uma no centro). Após a eletroforese a 5 V/cm, os géis foram visualizados em um transluminador com luz UV e fotografados.

Resultados

A maioria dos 14 pacientes selecionados era HIV positiva. Os 34 isolados foram testados bioquimicamente (Tabela 1), e a PRA, com a utilização de BstEII e HaeIII, gerou os padrões de PRA-hsp65 mostrados na Figura 1. Os isolados foram submetidos a especiação complementar por meio de testes bioquímicos convencionais, e a maioria mostrou o perfil bioquímico típico do complexo Mycobacterium avium (CMA). Os resultados da PRA e da identificação bioquímica foram na maior parte concordantes; entretanto, para um isolado, houve uma discrepância entre o padrão gerado por PRA e os resultados da identificação fenotípica. O isolado do paciente 1 (em uma amostra de líquido cefalorraquidiano) foi bioquimicamente identificado como M. flavescens, enquanto o padrão da PRA foi indicativo de M. monacense. Essa última cepa é uma nova espécie dentro do gênero Mycobacterium: é pigmentada e cresce em menos de uma semana em meio sólido; portanto, sua diferenciação do M. flavescens pelo método fenotípico é muito difícil. Entretanto, o método de PRA diferencia facilmente as duas espécies, porque os padrões de bandas da PRA do M. flavescens e do M. monacense são, respectivamente, BstEII 440/0/0-HaeIII 150/85/55/0 e BstEII 235/130/85-HaeIII 140/55/50/0. A concordância geral entre os dois métodos foi de 95,9% (para 47 de 49 isolados). O M. avium foi isolado principalmente de sangue, liquor, linfonodos, espécimes de biópsia e infecção disseminada. Todos os pacientes estavam em tratamento para HIV, exceto o paciente 11 (que era HIV negativo) e o paciente 8 (cujo status HIV era desconhecido).








Discussão

Em indivíduos imunocomprometidos, as infecções por MNT são apontadas como uma das principais causas de morbidade e mortalidade.(6) Empregamos técnicas fenotípicas e moleculares para estudar MNT isoladas de fontes estéreis em pacientes internados entre 2001 e 2006. Os pacientes eram HIV positivos em tratamento, exceto o paciente 11 (que era HIV negativo) e o paciente 8 (cujo status HIV era desconhecido). No presente estudo, optamos por utilizar o método de PRA porque ele é rápido e de fácil execução, e também porque ele é capaz de identificar várias espécies de micobactérias em um único experimento. O método de PRA tem um espectro mais amplo do que os outros métodos moleculares porque ele amplifica um gene hsp65 conservado que está presente em todas as micobactérias e em algumas bactérias, tais como Nocardia spp. As micobactérias são ubíquas na natureza, podendo ser encontradas em solo, poeira, rochas, bioaerossóis e água.(7) Esses organismos vêm sendo cada vez mais identificados em ambientes nos quais as condições são duras (poucos nutrientes, pH baixo e temperaturas extremas).

A formação de biofilme é uma bem sucedida estratégia de sobrevivência para esses organismos muito hidrofóbicos. No presente estudo, dois isolados de válvulas cardíacas no paciente 11 (que era paciente de cirurgia cardíaca) foram identificados como M. abscessus, que foi provavelmente introduzido via contaminação intraoperatória. Micobactérias de crescimento rápido têm sido implicadas em surtos de infecções de ferida cirúrgica(8-11) e de abscessos pós-injeção.(12,13) Infecções relacionadas a cateteres também têm sido associadas a tais micobactérias.(14) Pseudossurtos de doenças, definidos como clusters de falsas infecções ou conjuntos artefatuais de infecções reais, têm sido associados a broncoscópios contaminados e água contaminada de torneira utilizada em equipamentos automatizados para limpeza endoscópica.(15,16) O paciente 14, que era HIV positivo, desenvolveu infecção disseminada por M. kansasii. Esse patógeno tem sido frequentemente isolado em sistemas de distribuição de água que abastecem pias e chuveiros domésticos, podendo ser adquirido do meio ambiente em vez de por transmissão inter-humana.(6,17) O M. kansasii geralmente causa infecção pulmonar, à semelhança da tuberculose pulmonar, e a maior incidência de tal infecção ocorre em pacientes com DPOC.(18,19) Entretanto, o M. kansasii pode infectar o sangue, o que pode levar à morte. A identificação das duas cepas a partir do líquido cefalorraquidiano do paciente 1 mostrou resultados discordantes. As cepas foram identificadas como M. flavescens por testes bioquímicos e como M. monacense pelo método de PRA. O M. monacense é uma espécie nova, não fotocromógena, de crescimento rápido e com pigmentação amarela. Com base somente na investigação fenotípica, a distinção entre essa espécie e outras cepas escotocromógenas de crescimento rápido conhecidas é problemática. Entretanto, ela difere de qualquer outra espécie de micobactéria em razão de seus padrões de bandas da PRA. Foi relatado que uma cepa de M. monacense foi responsável por uma infecção grave de ferida pós-traumática em um menino saudável.(20) Obtivemos 29 isolados de M. avium que infectava a maioria dos pacientes HIV positivos. Antes da pandemia da AIDS, o CMA era em grande parte responsável pelas pneumopatias em pacientes com doenças pulmonares crônicas básicas, tais como enfisema e bronquite crônica. Em 1981, com o advento da AIDS, o CMA passou a representar uma das doenças bacterianas mais comuns entre os pacientes com AIDS, sendo a forma disseminada da doença a principal manifestação clínica da infecção. Em 1997, Gadelha et al.(21) avaliaram a incidência de micobacteriose e a colonização dos tratos respiratório e intestinal pelo CMA em pacientes com AIDS na cidade do Rio de Janeiro (RJ). Apesar de as hemoculturas terem sido negativas, todos eles estavam em tratamento com highly active antiretroviral therapy (HAART, terapia antirretroviral de alta potência). Em São Paulo, da Silva et al. isolaram 103 cepas a partir de sangue, linfonodo, e amostras de biópsia e, utilizando o método de PRA, identificaram 24 isolados como M. avium.(1) Ferreira et al. determinaram a prevalência de isolados de MNT em um hospital de referência para AIDS no Rio de Janeiro durante o período de um ano, antes da era HAART.(22) Os autores isolaram 83 espécimes de 35 pacientes, utilizando testes bioquímicos para determinar as espécies e amplificação do IS1245 para identificar o M. avium. Naquele estudo, o M. avium. pareceu predominar nos isolados de sangue estéril dos pacientes internados.(22)

O presente estudo descreveu as MNT isoladas de sítios estéreis em um período de seis anos na era HAART, no mesmo hospital universitário onde o estudo de Ferreira et al. foi realizado.(22) Identificamos 34 isolados de 14 pacientes, uma média de 2,3 pacientes/ano, o que aponta o impacto da HAART nas infecções por MNT. O gênero Mycobacterium inclui um grande número de espécies, e o número real de espécies taxonomicamente válidas é flutuante em razão do uso de sinônimos e da frequente descoberta de novas espécies de micobactérias. A diferenciação convencional de MNT por meio de cultura e de características bioquímicas é virtualmente impossível atualmente. No presente estudo, todas as cepas identificadas como CMA por meio de características fenotípicas mostraram um padrão de banda de PRA de M. avium tipo I. Silva et al.(1) compararam o método de PRA e a técnica de identificação fenotípica em um contexto de rotina. Entre os 24 isolados de M. avium, apenas 6 pertenciam ao sítio de PRA do tipo I. Em nosso estudo, a PRA foi comparada à identificação bioquímica, e os resultados mostraram que o método de PRA também é uma alternativa válida aos métodos convencionais (não moleculares) de identificação. Foi necessário menos de uma semana para completar a PRA, encurtando o tempo para o diagnóstico final. A principal desvantagem do uso rotineiro da PRA é a análise de padrões. Há relatos de diferenças entre tamanhos calculados de fragmentos de restrição e padrões publicados,(4,23) e isso pode ser devido a diferenças nas condições de execução, no tipo de gel de agarose utilizado ou no tipo de programa de computador utilizado. Em nossa experiência, o uso da PRA em conjunto com a avaliação das características fenotípicas resolve o problema de identificação da PRA; por exemplo, o M. gordonae tipo V e o M. avium tipo I têm padrões de PRA muito semelhantes (BstEII 235/210/0-HaeIII 130/115/0/0 e BstEII 235/210/0-HaeIII 130/105/0/00, respectivamente). Entretanto, o M. gordonae tem pigmentação amarela e o M. avium não tem pigmentação.

Em um contexto de rotina, a identificação rápida do complexo M. tuberculosis, do M. avium, do M. kansasii, do M. fortuitum e do M. abscessus é importante porque o tipo de tratamento é diferente para cada uma dessas espécies. Em nosso estudo, a identificação dessas espécies com base na PRA foi realizada por meio de visualização simples em gel de agarose. Isso confirma a utilidade dessa técnica, mesmo em serviços onde sistemas informatizados não estão disponíveis.

Em conclusão, o presente estudo demonstrou que a PRA é um método rápido, de baixo custo e preciso para a identificação de micobactérias patogênicas e potencialmente patogênicas. Para a identificação final e a especiação mais detalhada de MNT, os padrões de bandas da PRA devem ser considerados juntamente com algumas características fenotípicas, tais como a produção de pigmentação e a taxa de crescimento.



Referências

1. da Silva CF, Ueki SY, Geiger Dde C, Leão SC. hsp65 PCR-restriction enzyme analysis (PRA) for identification of mycobacteria in the clinical laboratory. Rev Inst Med Trop Sao Paulo. 2001;43(1):25-8.

2. Plikaytis BB, Plikaytis BD, Yakrus MA, Butler WR, Woodley CL,
Silcox VA, et al. Differentiation of slowly growing Mycobacterium species, including Mycobacterium tuberculosis, by gene amplification and restriction fragment length polymorphism analysis. J Clin Microbiol. 1992;30(7):1815-22.

3. Telenti A, Marchesi F, Balz M, Bally F, Böttger EC, Bodmer T. Rapid identification of mycobacteria to the species level by polymerase chain reaction and restriction enzyme analysis. J Clin Microbiol. 1993;31(2):175-8.

4. Devallois A, Goh KS, Rastogi N. Rapid identification of mycobacteria to species level by PCR-restriction fragment length polymorphism analysis of the hsp65 gene and proposition of an algorithm to differentiate 34 mycobacterial species. J Clin Microbiol. 1997;35(11):2969-73.

5. Kent PT, Kubica GP. Public Health Mycobacteriology: A Guide for the Level III Laboratory. Atlanta: U.S. Dept. of Health and Human Services, Public Health Service, Centers for Disease Control; 1985.

6. Falkinham JO 3rd. Epidemiology of infection by nontuberculous mycobacteria. Clin Microbiol Rev. 1996;9(2):177-215.

7. De Groote MA, Huitt G. Infections due to rapidly growing mycobacteria. Clin Infect Dis. 2006;42(12):1756-63.

8. Wallace RJ Jr, Brown BA, Griffith DE. Nosocomial outbreaks/pseudo-outbreaks caused by nontuberculous mycobacteria. Annu Rev Microbiol. 1998;52:453-90.

9. Wallace RJ Jr, Musser JM, Hull SI, Silcox VA, Steele LC, Forrester GD, et al. Diversity and sources of rapidly growing mycobacteria associated with infections following cardiac surgery. J Infect Dis. 1989;159(4):708-16.

10. Freitas D, Alvarenga L, Sampaio J, Mannis M, Sato E, Sousa L, et al. An outbreak of Mycobacterium chelonae infection after LASIK. Ophthalmology. 2003;110(2):276-85.

11. Vijayaraghavan R, Chandrashekhar R, Sujatha Y, Belagavi CS. Hospital outbreak of atypical mycobacterial infection of port sites after laparoscopic surgery. J Hosp Infect. 2006;64(4):344-7.

12. Galil K, Miller LA, Yakrus MA, Wallace RJ Jr, Mosley DG, England B, et al. Abscesses due to mycobacterium abscessus linked to injection of unapproved alternative medication. Emerg Infect Dis. 1999;5(5):681-7.

13. Villanueva A, Calderon RV, Vargas BA, Ruiz F, Aguero S, Zhang Y, et al. Report on an outbreak of postinjection abscesses due to Mycobacterium abscessus, including management with surgery and clarithromycin therapy and comparison of strains by random amplified polymorphic DNA polymerase chain reaction. Clin Infect Dis. 1997;24(6):1147-53.

14. Wallace RJ Jr, Swenson JM, Silcox VA, Good RC, Tschen JA, Stone MS. Spectrum of disease due to rapidly growing mycobacteria. Rev Infect Dis. 1983;5(4):657-79.

15. Fraser VJ, Jones M, Murray PR, Medoff G, Zhang Y, Wallace RJ Jr. Contamination of flexible fiberoptic bronchoscopes with Mycobacterium chelonae linked to an automated bronchoscope disinfection machine. Am Rev Respir Dis. 1992;145(4 Pt 1):853-5.

16. Fraser V, Wallace RJ Jr. Nontuberculous mycobacteria. In: Mayhall CG, editor. Hospital Epidemiology and Infection Control. Philadelphia: Lippincott Williams & Wilkins; 1996.

17. Collins FM. Mycobacterial disease, immunosuppression, and acquired immunodeficiency syndrome. Clin Microbiol Rev. 1989;2(4):360-77.

18. Martínez-Moragón E, Menéndez R, Palasí P, Santos M, López Aldeguer J. Environmental mycobacterial diseases in patients with and without HIV infection: epidemiology and clinical course [Article in Spanish]. Arch Bronconeumol. 2001;37(6):281-6.

19. Koh WJ, Kwon OJ, Lee KS. Nontuberculous mycobacterial pulmonary diseases in immunocompetent patients. Korean J Radiol. 2002;3(3):145-57.

20. Reischl U, Melzl H, Kroppenstedt RM, Miethke T, Naumann L, Mariottini A, et al. Mycobacterium monacense sp. nov. Int J Syst Evol Microbiol. 2006;56(Pt 11):2575-8.

21. Gadelha A, Accácio N, Grinzstejn B, Veloso V, da Silveira LB, Fandinho F, et al. Low incidence of colonization and no cases of disseminated Mycobacterium avium complex infection (DMAC) in Brazilian AIDS patients in the HAART era. Braz J Infect Dis. 2002;6(5):252-7.

22. Ferreira RM, Saad MH, Silva MG, Fonseca Lde S. Non-tuberculous mycobacteria I: one year clinical isolates identification in Tertiary Hospital Aids Reference Center, Rio de Janeiro, Brazil, in pre highly active antiretroviral therapy era. Mem Inst Oswaldo Cruz. 2002;97(5):725-9.

23. da Silva Rocha A, da Costa Leite C, Torres HM, de Miranda AB, Pires Lopes MQ, Degrave WM, et al. Use of PCR-restriction fragment length polymorphism analysis of the hsp65 gene for rapid identification of mycobacteria in Brazil. J Microbiol Methods. 1999;37(3):223-9.



Trabalho realizado na Universidade Federal do Rio de Janeiro - UFRJ - Rio de Janeiro (RJ) Brasil.
Endereço para correspondência: Simone Gonçalves Senna. Departamento de Microbiologia Médica, Instituto de Microbiologia Prof. Paulo de Góes, Universidade Federal do Rio de Janeiro, Avenida Carlos Chagas Filho, 373, CCS, Bloco I, Lab. 011, Cidade Universitária, Ilha do Fundão, CEP 21941-902, Rio de Janeiro, RJ, Brasil
Tel. 55 21 2560-8344, ramal 134. E-mail: simonegsenna@yahoo.com.br
Apoio financeiro: Este estudo recebeu apoio financeiro do Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq) e da Fundação de Amparo à Pesquisa do Estado do Rio de Janeiro (FAPERJ).
Recebido para publicação em 19/1/2011. Aprovado, após revisão, em 2/5/2011.




Sobre os autores

Simone Gonçalves Senna
Pesquisadora. Departamento de Microbiologia Médica, Instituto de Microbiologia Prof. Paulo de Góes, Universidade Federal do Rio de Janeiro - UFRJ - Rio de Janeiro (RJ) Brasil.

Ana Grazia Marsico
Chefe. Laboratório de Micobactérias, Hospital Universitário Clementino Fraga Filho, Universidade Federal do Rio de Janeiro - HUCFF/UFRJ - Rio de Janeiro (RJ) Brasil.

Gisele Betzler de Oliveira Vieira
Chefe. Laboratório de Micobactérias, Hospital Universitário Clementino Fraga Filho, Universidade Federal do Rio de Janeiro - HUCFF/UFRJ - Rio de Janeiro (RJ) Brasil.

Luciana Fonseca Sobral
Pesquisadora. Laboratório de Micobactérias, Hospital Universitário Clementino Fraga Filho, Universidade Federal do Rio de Janeiro - HUCFF/UFRJ - Rio de Janeiro (RJ) Brasil.

Philip Noel Suffys
Chefe. Laboratório de Biologia Molecular Aplicada a Micobactérias, Fundação Oswaldo Cruz - FIOCRUZ - Rio de Janeiro (RJ) Brasil.

Leila de Souza Fonseca
Professora Titular. Universidade Federal do Rio de Janeiro - UFRJ - Rio de Janeiro (RJ) Brasil.

 

 


O Jornal Brasileiro de Pneumologia está indexado em:

Latindex Lilacs SciELO PubMed ISI Scopus Copernicus pmc

Apoio

CNPq, Capes, Ministério da Educação, Ministério da Ciência e Tecnologia, Governo Federal, Brasil, País Rico é País sem Pobreza
Secretaria do Jornal Brasileiro de Pneumologia
SCS Quadra 01, Bloco K, Salas 203/204 Ed. Denasa. CEP: 70.398-900 - Brasília - DF
Fone/fax: 0800 61 6218/ (55) (61) 3245 1030/ (55) (61) 3245 6218
E-mails: jbp@jbp.org.br
jpneumo@jornaldepneumologia.com.br

Copyright 2017 - Sociedade Brasileira de Pneumologia e Tisiologia

Logo GN1